View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15596_high_8 (Length: 236)
Name: NF15596_high_8
Description: NF15596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15596_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 52664646 - 52664425
Alignment:
| Q |
1 |
tatgtaaggaacttcaatctattgggattaagcttcaataatttgaattttaaggtattaattttatcggtttgaagaactcnnnnnnnn-ttaatttgg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
52664646 |
tatgtaaggaacttcaatctattgggattaagcttcaatagtttgaattttaaggtattaattttatgggtttgaagaactctaaaaaaaattaatttgg |
52664547 |
T |
 |
| Q |
100 |
aattttctaaatttctttttaaaagaagataatatggatgaagatgatgaaagttgatcggtaaaccaatatgaatttttatttttaatttgatgaagat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52664546 |
aattttctaaatttctttttaaaagaagataatatggatgaagatgatgaaagttgatcagtgaaccaatatgaatttttatttttaatttgatgaagat |
52664447 |
T |
 |
| Q |
200 |
aaggatgaataataggaagaag |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52664446 |
aaggatgaataataggaagaag |
52664425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University