View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15596_low_4 (Length: 367)
Name: NF15596_low_4
Description: NF15596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15596_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 5 - 165
Target Start/End: Original strand, 8725597 - 8725757
Alignment:
| Q |
5 |
ttttatggattaggaataaagtacttgaatgaaatgcctaggttgaattagttttgtttgtgaacttatgcatgactcataactgacagtttgatggtga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8725597 |
ttttatggattaggaataaagtacttgaatgaaatgcctaggttgaattagttttgtttgtgaacttatgcatgactcataactgacagtttgatggtga |
8725696 |
T |
|
| Q |
105 |
aatgtgaatctttgatttaaagggacagagaaaacctcctcaagaataatagaaaggggaa |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8725697 |
aatgtgaatctttgatttaaagggacagagaaaacctcctcaagaataatagaaaggggaa |
8725757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 291 - 349
Target Start/End: Original strand, 8726024 - 8726082
Alignment:
| Q |
291 |
aaatctcataaactctataaaccttaagcttgcatagttttctggtttaactgtttctg |
349 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
8726024 |
aaatctcataaactctagaaaccctaagcttgcacagttttctggtttaactgtttctg |
8726082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University