View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_high_8 (Length: 493)
Name: NF15598_high_8
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 231 - 476
Target Start/End: Original strand, 16700809 - 16701054
Alignment:
| Q |
231 |
gtcttgttgtcagcaaaactattataaaataaggacaagttattttgttggctaactcactttatttttaatnnnnnnncaacaacacacatctattttg |
330 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16700809 |
gtcttgttgtcagcaaaactatcataaaataaggacaagttattttgttggctaactcactttatttttaataaaaaaacaacaacacacatctattttg |
16700908 |
T |
|
| Q |
331 |
acatatcagaatggcgtggcaaaataattcaactcattttaccaactttattctagtagcatataatgacgtttaatattttgagtttttcaatataata |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16700909 |
acatatcagaatggcgtggcaaaataattcaactcattttaccaactttattctagtagcatataatgacgtttaatattttgagtttttcaatattata |
16701008 |
T |
|
| Q |
431 |
ataagattttgaacacaatagcttatattgtggacaagttataatt |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16701009 |
ataagattttgaacacaatagcttatattgtggacaagttataatt |
16701054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 16 - 150
Target Start/End: Original strand, 16700594 - 16700728
Alignment:
| Q |
16 |
atattataaacaaactattaattagtgtagggttatgcaacaaaatgaacatatcatatgaatataatctatgatacattttattccctaatctcaactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16700594 |
atattataaacaaactattaattagtgtagggttatgcaacaaaatgaacatatcatatgaatataatatatgatacattttattccctaatctcaactt |
16700693 |
T |
|
| Q |
116 |
tttaaaggcattatctcaaacttaaaccaattcca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16700694 |
tttaaaggcattatctcaaacttaaaccaattcca |
16700728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University