View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_low_18 (Length: 391)
Name: NF15598_low_18
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 16 - 372
Target Start/End: Complemental strand, 29140620 - 29140264
Alignment:
| Q |
16 |
gatgaacttgagtcaggacttctggtatagctgctaatcaaatctttctcaagcaaattgtcgaatgtgcttcggtttattggatggaatctttgtaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29140620 |
gatgaacttgagtcaggacttctggtatagctgctaatcaaatctttctcaagcaaattgtcgaatgtgcttcggtttattggatggaatctttgtaagt |
29140521 |
T |
|
| Q |
116 |
gaattccgtttgaggtttttaacaaaagaggagattttctcttcatggtttcatcatccaaggctaaaagggtatgtaattggagaatcgaactaattgc |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29140520 |
gaattccatttgaggtttttaacaaaagaggagattttctcttcatggtttcatcatccaaggctaaaagggtatgtaattggagaatcgaactaattgc |
29140421 |
T |
|
| Q |
216 |
tagtgcctccccggttttaacacgaagtttctcaaaatcaaggttttccaatttgctgacaacaggattgaattggaatggtgtatctaatttttcagct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29140420 |
tagtgcctccccggttttaacacgaagtttctcaaaatcaaggttttccaatttgctgacaacaggattgaattggaatggtgtatctaatttttcagct |
29140321 |
T |
|
| Q |
316 |
tctgcaatcagtctatgagctacctggtcgagaacctctttcttctgatgaacgccg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29140320 |
tctgcaatcagtctatgagctacctggtcgagaacctctttcttctgatgaacgccg |
29140264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 8e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 165 - 318
Target Start/End: Original strand, 2086040 - 2086193
Alignment:
| Q |
165 |
ttcatcatccaaggctaaaagggtatgtaattggagaatcgaactaattgctagtgcctccccggttttaacacgaagtttctcaaaatcaaggttttcc |
264 |
Q |
| |
|
||||||||||||||| ||||||| |||||| || ||||| |||||||| || || ||||| |||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
2086040 |
ttcatcatccaaggccaaaagggaatgtaactgcagaatagaactaatagcaagcgcctcgccggttttcacacgaagtttgtcaaaatcaagattttct |
2086139 |
T |
|
| Q |
265 |
aatttgctgacaacaggattgaattggaatggtgtatctaatttttcagcttct |
318 |
Q |
| |
|
| ||||| | |||||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2086140 |
agcttgctaagaacagggttgaattggaatggtatatctaatttctcagcttct |
2086193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University