View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_low_22 (Length: 332)
Name: NF15598_low_22
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 13 - 170
Target Start/End: Original strand, 38224965 - 38225119
Alignment:
| Q |
13 |
aatatattttctgatacaatttaaagacagttttcaaaatttgcaacttggatatatcaaattataatgagagggtccaattttatatctctaactatta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38224965 |
aatatattttctgatacaatttaaagacagttttcaaaatttgcaacttggatatatcaaattataatgagagggtccaattttatatctctaactatta |
38225064 |
T |
 |
| Q |
113 |
aatgttttctaaaacaaattttaggcacccgcaggatttgaggatctatgtctagttc |
170 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38225065 |
aatgttttc---aacaaattttaggcacccacaggatttgaggatctatgtctagttc |
38225119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 237 - 315
Target Start/End: Original strand, 38225186 - 38225264
Alignment:
| Q |
237 |
ctactactccccctcgagcaaaaattggcccttcagaaattgttcaaataaaaaagtgctcttttattttactaatact |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225186 |
ctactactccccctcgagcaaaaattggccctgcagaaattgttcaaataaaaaagtgctcttttattttactaatact |
38225264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University