View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_low_26 (Length: 315)
Name: NF15598_low_26
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 3353453 - 3353222
Alignment:
| Q |
19 |
cacagagaccattcaagacagagaagccggtaacgttagcgaaagtgaacccgagtgcgccaccggctaagctgagctcacctagtcgacccaagaatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
3353453 |
cacagagaccattcaagacagagaagccggtaacgttagcgaaagtgaacccgagtgcgccaccggctaacctgagctcacctagtctacccaagaatgc |
3353354 |
T |
 |
| Q |
119 |
tgttgtgatagctgtcttggcaaaccaagctaaattcatcaacaccattggaaaagctaatcttccttgaactcttagctcctctgaaagcaacgacttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3353353 |
tgttgtgatagctgtcttggcaaaccaagctaaattcatcaacaccattggaaaagctaatcttccttgaactcttagctcctctgaaagcaacgacttc |
3353254 |
T |
 |
| Q |
219 |
cccggatttgtgtcgcattttcgggtttgtaa |
250 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
3353253 |
cccggatttatgtcgcattttcgggtttgtaa |
3353222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University