View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_low_31 (Length: 240)
Name: NF15598_low_31
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 24399741 - 24399554
Alignment:
| Q |
35 |
gccaaaactaaaacgtgttgcaactgagaccacattaaaatgtgaatgtcactgttatcgtgactgcaatttaaaacctgctcaaaatctaaaattcgcg |
134 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24399741 |
gccaaaactaaaacatgttgcaactgaggccacattaaaacgtgaatgtcactgttatcgtgactgcaatttaaaacctgctcaaaatctaaaagtcgcg |
24399642 |
T |
 |
| Q |
135 |
atgaaaaatatttcggtaatgttgacctgtaaagaagattttgtcccatttttgccgtaataattggtcggattcctgtggtccccct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24399641 |
atgaaaaatatttcggtaatgttgacctgtaaagaagattttgtcccatttttgacgtaataattggtcggattcctgtggtccccct |
24399554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University