View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_low_33 (Length: 234)
Name: NF15598_low_33
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 25 - 218
Target Start/End: Complemental strand, 43164570 - 43164377
Alignment:
| Q |
25 |
cttcttgcatgttgcaaaatgacgaatcagaagctgaagcccttgacaggtggagtatttgctacacggtttcttttctttattaacctccacatggtat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164570 |
cttcttgcatgttgcaaaatgacgaatcagaagctgaagcccttgacaggtggagtatttgctacacggtttcttttctttattaacctccacatggtat |
43164471 |
T |
|
| Q |
125 |
ggtccaacgtcggtgcacccttccgtacatatatgctccaaacactccatcgcctccgaaagttccgcatacaacccttgctcctccctatgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164470 |
ggtccaacgtcggtgcacccttccgtacatatatgctccaaacactccatcgcctccgaaagttccgcatacaacccttgctcctccctatgct |
43164377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University