View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15598_low_36 (Length: 219)
Name: NF15598_low_36
Description: NF15598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15598_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 45 - 206
Target Start/End: Complemental strand, 2222846 - 2222672
Alignment:
| Q |
45 |
ttattgtttttactaccagaatccgatgttacatgtgacata----gtgtatatatattggtgtactaaaacacatatctaagcaaatttatgaaatgtt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222846 |
ttattgtttttactaccagaatccgatgttacatgtgacatatatagtgtatatatattggtgtactaaaacacatatctaagcaaatttatgaaatgtt |
2222747 |
T |
|
| Q |
141 |
tgatttatcttcttgaaggaggaaactatc---------gttgctttttgtatacgtatatgagacatgagattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222746 |
tgatttatcttcttgaaggaggaaactatcgatggcatggttgctttttgtatacgtatatgagacatgagattg |
2222672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University