View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15599_low_1 (Length: 214)
Name: NF15599_low_1
Description: NF15599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15599_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 9579892 - 9579707
Alignment:
| Q |
12 |
tcatcatacataaacctcgcagaacaatcatcatattttaatatacattttctacgnnnnnnnnnnnnnnnnnttcgatccacatatctattaacggtca |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9579892 |
tcatcatacataaacctcacagaacaatcatcatattttaatatacattttctacatctctttttttctctctttcgatccacatatctattaacggtca |
9579793 |
T |
 |
| Q |
112 |
attatatgtcttctacagaattacaacgcaaaaatttcagattttgggttggctaaatttgggccatctggaggagattcacatgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9579792 |
attatatgtcttctacagaattacaatgcaaaaatttcagattttgggttggctaaatttgggccatctggtggagattcacatgt |
9579707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University