View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1559_low_6 (Length: 223)
Name: NF1559_low_6
Description: NF1559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1559_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 39684134 - 39683943
Alignment:
| Q |
16 |
aatataacgaactaattttcaaattcgattagttggaagagacgatctgaaagtgcttcgaataaaataatcttagtatattgaacatagggaaaaccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39684134 |
aatataacgaactaattttcaaattcgattagttggaagagacgatctgaaagtgcttcgaataaagtaatcttagtatattgaacatagggaaaaccaa |
39684035 |
T |
 |
| Q |
116 |
agaatnnnnnnnnnnnnnttactcaaccaaggcaaagcatctggtgaggtgccaactctttttctttttgtcgaaagattaggagatgttag |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39684034 |
agaataaaaatgaaaaaattactcaaccaaggcaaagcatctggtgaggtgccaactctttttctttttgtcgaaagattaggagatgttag |
39683943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University