View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1559_low_6 (Length: 223)

Name: NF1559_low_6
Description: NF1559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1559_low_6
NF1559_low_6
[»] chr5 (1 HSPs)
chr5 (16-207)||(39683943-39684134)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 39684134 - 39683943
Alignment:
16 aatataacgaactaattttcaaattcgattagttggaagagacgatctgaaagtgcttcgaataaaataatcttagtatattgaacatagggaaaaccaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
39684134 aatataacgaactaattttcaaattcgattagttggaagagacgatctgaaagtgcttcgaataaagtaatcttagtatattgaacatagggaaaaccaa 39684035  T
116 agaatnnnnnnnnnnnnnttactcaaccaaggcaaagcatctggtgaggtgccaactctttttctttttgtcgaaagattaggagatgttag 207  Q
    |||||             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39684034 agaataaaaatgaaaaaattactcaaccaaggcaaagcatctggtgaggtgccaactctttttctttttgtcgaaagattaggagatgttag 39683943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University