View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15601_high_11 (Length: 290)
Name: NF15601_high_11
Description: NF15601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15601_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 269
Target Start/End: Original strand, 54267930 - 54268188
Alignment:
| Q |
10 |
gacatcatcataacggaaggtgggaggcacggattggcaaagtttttggcaataagtatctttatctcggaacatatggtaagttcaaaatctttgtctc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54267930 |
gacatcatcataacggaaggtgggaggcacggattggcaaagtttttggcaataagtatctttatctcggaacatatggtaagttcaaaatctttgtctc |
54268029 |
T |
|
| Q |
110 |
taattatcttggcaaacaatgaaatactgtacacaccttttctttcacaaaataaaatacgtacgtacatatgaacactagataatgtacgtataaatgc |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
54268030 |
taattatcttagcaaacaatgaaatactgtacacaccttttctttcacaaaataaaatacgtacgtacatatgaacactag-tgatgtacgtataaatgc |
54268128 |
T |
|
| Q |
210 |
tcgtatggtgcgtaaaatgttctttactactataattatgactagtagttaagtagctag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54268129 |
tcgtatggtgcgtaaaatgttctttactactataattatgactagtagttaagtagctag |
54268188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 25051874 - 25051958
Alignment:
| Q |
10 |
gacatcatcataacggaaggtgggaggcacggattggcaaagtttttggcaataagtatctttatctcggaacatatggtaagtt |
94 |
Q |
| |
|
|||| ||||||||||||||||||||||| || || || | ||||||||||| || ||||||||||| |||||||||||| |||| |
|
|
| T |
25051874 |
gacaccatcataacggaaggtgggaggctcgtatcggtagggtttttggcaacaaatatctttatcttggaacatatggttagtt |
25051958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University