View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15601_high_14 (Length: 257)
Name: NF15601_high_14
Description: NF15601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15601_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 28469718 - 28469937
Alignment:
| Q |
18 |
atcaccacacaactagagacataatacgattgatttagtcttaattgccgtttacaaagatataaaataaacaaacatcgatgtcacgagctagattgcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28469718 |
atcaccacacaactagagacataatacgattgatttagtcttaattgccgttg-caaagatataaaataaactaacatcgatgtcacgagctagattgcg |
28469816 |
T |
|
| Q |
118 |
accattgacgtttctaaaatatattttactatcaaggatggttttaaattacggctgcacttacgctatatttcaacaaaatgccgagaaatgtgaccat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28469817 |
accattgacgtttctaaaatatattttactatcaaggatggttttaaattacggctgaacttacgctatatttcaacaaaatgccgagaaatgtgaccat |
28469916 |
T |
|
| Q |
218 |
tgcgattgaaattgtggtaac |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28469917 |
tgcgattgaaattgtggtaac |
28469937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University