View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15602_high_7 (Length: 455)
Name: NF15602_high_7
Description: NF15602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15602_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 49 - 289
Target Start/End: Complemental strand, 34675259 - 34675014
Alignment:
| Q |
49 |
tgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctacaaagcaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675259 |
tgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctacaaagcaa |
34675160 |
T |
|
| Q |
149 |
tnnnnnnn-tattgagtcatacaaaatatgaatctatttatcttctaactttcccttc--tacatcgtgttttcaagtaataatcagttttagtttcaaa |
245 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34675159 |
taaaaaaaatattgagtcatacaaaatatgaatctatttatcttctaactttcccttctatacatcgtgttttcaagtaataatcag-tttagtttcaaa |
34675061 |
T |
|
| Q |
246 |
agttattacaaaactcaatggtcacaaata---aatatcagatctaa |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34675060 |
agttattacaaaactcaatggtcacaaataaagaatatcagatctaa |
34675014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 34675188 - 34675224
Alignment:
| Q |
21 |
catcatcaagctcatacaattcaccatgtgcagcctg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675188 |
catcatcaagctcatacaattcaccatgtgcagcctg |
34675224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 128
Target Start/End: Complemental strand, 43583248 - 43583166
Alignment:
| Q |
49 |
tgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagct---tgatgatgccattttt |
128 |
Q |
| |
|
|||| |||||||||||||||| | | |||||||||||| ||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
43583248 |
tgcatcctggcatgcattttctcctcaagaatttgcaggcagcacaaggtgaattgtatgagctggatgatgatgccattttt |
43583166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University