View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15604_low_8 (Length: 211)
Name: NF15604_low_8
Description: NF15604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15604_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 45403319 - 45403498
Alignment:
| Q |
18 |
aaacatgagttctctaggagaaataatgctgttattaatttctagccctaggttttgaaaaataggttttgtggcgatgtttaaaggagaacgatatttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45403319 |
aaacatgagttctctaggagaaataatgctgttattaatttctagccctaggttttgaaaaataggttttgtggcgatgtttaaaggggaacgatatttt |
45403418 |
T |
|
| Q |
118 |
cgtgaagttgttgatcttgattccttaaacgcgttccaatcttgttctagtttcttgtatttctgatgaagttctcttgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403419 |
cgtgaagttgttgatcttgattccttaaacgcgttccaatcttgttctagtttcttgtatttctgatgaagttctcttgt |
45403498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University