View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15605_high_18 (Length: 354)
Name: NF15605_high_18
Description: NF15605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15605_high_18 |
 | |
|
| [»] scaffold0056 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 156 - 322
Target Start/End: Original strand, 21211016 - 21211182
Alignment:
| Q |
156 |
cacaatctcaatgttacataattatggttttattgtaatttgggagtgttagttgtcccataacacaaaccatgattgtgaaattattggcagttgatca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21211016 |
cacaatctcaatgttacataattatggttttattgtaatttgggagtgttagttgtcccataacacaaaccatgattgtgaaattattggcagttgatca |
21211115 |
T |
|
| Q |
256 |
atcacggagtcaatcctttattggtggaaaattttaaaaaacttgttcaagacttcttcaatctgcc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21211116 |
atcacggagtcaatcctttattggtggaaaattttaaaaaacttgttcaagacttcttcaatctgcc |
21211182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 21210648 - 21210703
Alignment:
| Q |
2 |
agttggtcatttatataaatacatatgcattgctctcggaatatcaacactaaactgc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21210648 |
agttggtcatttata--aatacatatgcatcgctctcggaatatcaacactaaactgc |
21210703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 246 - 287
Target Start/End: Complemental strand, 23023007 - 23022966
Alignment:
| Q |
246 |
cagttgatcaatcacggagtcaatcctttattggtggaaaat |
287 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
23023007 |
cagttgattaatcacggagtcgatcctttattggtggaaaat |
23022966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 287
Target Start/End: Original strand, 22927904 - 22927945
Alignment:
| Q |
246 |
cagttgatcaatcacggagtcaatcctttattggtggaaaat |
287 |
Q |
| |
|
|||||||| |||||||||||| ||| |||||||||||||||| |
|
|
| T |
22927904 |
cagttgattaatcacggagtcgatcatttattggtggaaaat |
22927945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 177 - 325
Target Start/End: Complemental strand, 26915180 - 26915032
Alignment:
| Q |
177 |
ttatggttttattgtaatttgggagtgttagttgtcccataacacaaaccatgattgtgaaattattggcagttgatcaatcacggagtcaatcctttat |
276 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26915180 |
ttatggttttattgtaatttggtagtgttagttgtcccgtaacatgaaccatgattttcaaattattggcagttgatcaatcacggagtcaatcctttat |
26915081 |
T |
|
| Q |
277 |
tggtggaaaattttaaaaaacttgttcaagacttcttcaatctgccagt |
325 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26915080 |
tggtggaaaattttaaaaaacttgtccaagacttcttcaatctgccagt |
26915032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 319
Target Start/End: Complemental strand, 63440 - 63371
Alignment:
| Q |
250 |
tgatcaatcacggagtcaatcctttattggtggaaaattttaaaaaacttgttcaagacttcttcaatct |
319 |
Q |
| |
|
|||||||||| |||||| ||| | |||||| |||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
63440 |
tgatcaatcatggagtcgatctatcattggttgaaaatttcaaaaaacatgttcaagagttcttcaatct |
63371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University