View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15605_high_31 (Length: 332)
Name: NF15605_high_31
Description: NF15605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15605_high_31 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 30 - 332
Target Start/End: Complemental strand, 6315347 - 6315045
Alignment:
| Q |
30 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6315347 |
ccatctgcccaacaagtctccgttgctactaatccacctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaa |
6315248 |
T |
|
| Q |
130 |
tctccaaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315247 |
tctccaaattctaagtattttgctgctttttcttttgccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagct |
6315148 |
T |
|
| Q |
230 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatgacagtaaaaataaactctgcaca |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6315147 |
gcttacttcttctcttccatatattccacaacaccatagttaaaccattcataatcattgttgtgcagttgttgatgacagtaaaaataaattctgcaca |
6315048 |
T |
|
| Q |
330 |
tga |
332 |
Q |
| |
|
||| |
|
|
| T |
6315047 |
tga |
6315045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 273 - 320
Target Start/End: Complemental strand, 6318236 - 6318189
Alignment:
| Q |
273 |
accattcataatcattgttgtgcagttgttgatgacagtaaaaataaa |
320 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6318236 |
accattcataatccttgttgtgcagctgttgatgacagtaaaattaaa |
6318189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University