View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15605_high_40 (Length: 311)
Name: NF15605_high_40
Description: NF15605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15605_high_40 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 22 - 311
Target Start/End: Original strand, 32731839 - 32732128
Alignment:
| Q |
22 |
catcatcaccaccggttatcctgaccctccggcgcatgggtcagcatagccgccgtgagtcctacccttctgcgtcatacgacttcctccaccaacgcca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32731839 |
catcatcaccaccggttatcctgaccctccggcgcatgggtcagcatagccgccgtgagtcctacccttctgcgtcatacgacttcctccaccaacgcca |
32731938 |
T |
 |
| Q |
122 |
tattgaaacggttattggtgaagaagatgggctggaatggccatttggaaatgtggaaagtatgagcgctgatgatgtgagggagacagcgtatgggatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32731939 |
tattgaaacggttattggtgaagaagatgggctggaatggccatttggaaatgtggaaagtatgagcgctgatgatgtgagggagacagcgtatgagatc |
32732038 |
T |
 |
| Q |
222 |
tttttcacgtcatgccgatcaacgccggggttcggtggacgtcaaacgctgacgttttattctaaccatgagaataatggaggtggtgga |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
32732039 |
tttttcacgtcatgccgatcaacgccggggtttggtggacgtcaaacgctgacgttttattctaaccatgacaatagtggaggtggtgga |
32732128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University