View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15605_high_43 (Length: 306)
Name: NF15605_high_43
Description: NF15605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15605_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 30 - 286
Target Start/End: Original strand, 41653342 - 41653598
Alignment:
| Q |
30 |
atcaaagggtcagcaccagcaaaatttatgctacccttatgttgagtagagttaaacacaaatgagaaaccaagccaagcagtgaaaatttctttcttat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653342 |
atcaaagggtcagcaccagcaaaatttatgctacccttatgttgagtagagttaaacacaaatgagaaaccaagccaagcagtgaaaatttctttcttat |
41653441 |
T |
|
| Q |
130 |
cataaatgtaaaatccttgagcacgaccaattgggcgtgagtgtaagttattgtccaaagtgattggatcatcaaaaacaaccaaatcaccaaaatggtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653442 |
cataaatgtaaaatccttgagcacgaccaattgggcgtgagtgtaagttattgtccaaagtgattggatcatcaaaaacaaccaaatcaccaaaatggtt |
41653541 |
T |
|
| Q |
230 |
ttggtttgccaatatggttcggttaccccatgctggtgtgcctacaattgatgatgt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41653542 |
ttggtttgccaatatggttcggttaccccatgctggtgtgcctacaattgctgatgt |
41653598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University