View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15606_low_12 (Length: 296)
Name: NF15606_low_12
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15606_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 15850258 - 15849996
Alignment:
| Q |
15 |
cataggaatgtcggacaccgtaacacggttggttcaagaggtgtccgtgcttcataggttgagtcttcactacaacttgagtctctaattgccctttaag |
114 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15850258 |
cataggagtgtcggacaccgtaatacggctggttcaagaggtgtccgtgcttcataggttgagtcttcactacaacttgagtctctaattgccctttaag |
15850159 |
T |
|
| Q |
115 |
ttggttctgcatttaaatttgaacaacatgttgagaagccaattcagctctaacatccgctgagaatgttgaaactcagtagcagacacaaactctgctg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || | |
|
|
| T |
15850158 |
ttggttctgcatttaaatttgaacaacatgtcgagaagccaattcagctctaacatccgctaagaatgttgaaactcagtagcagacacaaactcagcag |
15850059 |
T |
|
| Q |
215 |
agttcttaggtatggggtcagagtcagagataactatgttatcaagcttcggaagcactatag |
277 |
Q |
| |
|
|||||| |||| | |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15850058 |
agttctgaggtcttgggtcagagtcagagataactatgttatcaagcttcagaagcactatag |
15849996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 43921714 - 43921666
Alignment:
| Q |
23 |
tgtcggacaccgtaacacggttggttcaagaggtgtccgtgcttcatag |
71 |
Q |
| |
|
||||||||||||| |||||| | || | ||||||||||||||||||||| |
|
|
| T |
43921714 |
tgtcggacaccgtgacacggctagtcctagaggtgtccgtgcttcatag |
43921666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University