View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15606_low_13 (Length: 287)
Name: NF15606_low_13
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15606_low_13 |
 | |
|
| [»] scaffold0365 (1 HSPs) |
| | |
|
| [»] scaffold0400 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0365 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 14 - 267
Target Start/End: Original strand, 2492 - 2745
Alignment:
| Q |
14 |
gcaaaggagaaggggatatttaataaggatgaaagttggaggaagaaattgcaaggtcttgttcctgctgatgggataaaagtgaagcatattcgtacag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2492 |
gcaaaggagaaggggatatttaataaggatgaaagttggaggaagaaattgcaaggtcttgttcctgctgatgggataaaagtgaagcatattcgtacag |
2591 |
T |
|
| Q |
114 |
gtgaagatgtgaagctttcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2592 |
gtgaagatgtgaagctttcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtt |
2691 |
T |
|
| Q |
214 |
tgagaactttgatggtaggcttgagtttaaagggaacaattttggtgctgtttg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2692 |
tgagaactttgatggtaggcttgagtttaaagggaacaattttggtgctgtttg |
2745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 131 - 267
Target Start/End: Original strand, 1965 - 2101
Alignment:
| Q |
131 |
tcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatggta |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965 |
tcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatggta |
2064 |
T |
|
| Q |
231 |
ggcttgagtttaaagggaacaattttggtgctgtttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065 |
ggcttgagtttaaagggaacaattttggtgctgtttg |
2101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University