View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15606_low_15 (Length: 272)
Name: NF15606_low_15
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15606_low_15 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 51718194 - 51717939
Alignment:
| Q |
10 |
gattcgaaccccaacccctacttataacat-----gcaatgttatttgaagcataatggaacactcttaatatgttctttgaattgcatttagaattaag |
104 |
Q |
| |
|
||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51718194 |
gattcgaaccccaacccctacatataatataatatgcaatgttatttgaagcataatggaacactcttaatatgttctttgaattgcatttagaattaag |
51718095 |
T |
 |
| Q |
105 |
cgaggaacaaagctctttaatgctaaatataagatgtgctttgattggccaactctttattaatgaaccgtaaaattgtgtttcaagtatatccacttta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51718094 |
cgaggaacaaagctctttaatgctaaatataagacgtgctttgattggccaactctttattaatgaaccgtaaaattgtgtttcaagtatatccacttta |
51717995 |
T |
 |
| Q |
205 |
tgataaatcaagatatattaaacacacaactgcgcatactaatctcaaaaaatatt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51717994 |
tgataaatcaagatatattaaacacacaactgtgcatactaatctcaaaaaatatt |
51717939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 65792 - 65828
Alignment:
| Q |
8 |
gggattcgaaccccaacccctacttataacatgcaat |
44 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
65792 |
gggattcgaaccccaacccctacatataatatgcaat |
65828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 8698585 - 8698621
Alignment:
| Q |
8 |
gggattcgaaccccaacccctacttataacatgcaat |
44 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
8698585 |
gggattcgaaccccaacccctacatataatatgcaat |
8698621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University