View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15606_low_17 (Length: 267)
Name: NF15606_low_17
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15606_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 138 - 254
Target Start/End: Complemental strand, 42014987 - 42014868
Alignment:
| Q |
138 |
tacggatagaatacactttttgcgttatctatcagcaggactgtaaaatattt---nnnnnnnnnnnnnnntggtatagttctgtatcccctaaacttct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42014987 |
tacggatagaatacactttttgcgttatctatcagcaggactgtaaaatatttaaaaaaataaaataaaaatggtatagttctgtatcccctaaacttct |
42014888 |
T |
|
| Q |
235 |
cttccatgtcacattcattt |
254 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
42014887 |
cttccatgtcacattgattt |
42014868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 42015141 - 42015088
Alignment:
| Q |
16 |
caattagttcaaaaacagtcatgaataagaaaagtaagttgcgtaagctcttgg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42015141 |
caattagttcaaaaacagtcatgaataagaaaagtaagttgcgtaagctcttgg |
42015088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 69
Target Start/End: Complemental strand, 42015087 - 42015056
Alignment:
| Q |
38 |
gaataagaaaagtaagttgcgtaagctcttgg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42015087 |
gaataagaaaagtaagttgcgtaagctcttgg |
42015056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University