View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15606_low_19 (Length: 264)
Name: NF15606_low_19
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15606_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 24 - 250
Target Start/End: Original strand, 17945791 - 17946017
Alignment:
| Q |
24 |
agtccatacaagaatcccaaaatgatcgtttggtttcgccatttcttcttcagttggtttgtcagttaatatgtgagttccaaaaggttgttttggtttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17945791 |
agtccatacaagaatcccaaaatgatcgtttggttttgccatttcttcttcagttggtttgtcaattaatatgtgagttccaaaaggttgttttggtttt |
17945890 |
T |
 |
| Q |
124 |
gcactttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcacttgttttctcgagccatttgcgagttccaaaaaattgatttg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17945891 |
acactttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcacttgttttctcgagccatttgcgagttccaaaaaattgatttg |
17945990 |
T |
 |
| Q |
224 |
cttttttgacctgtaaatgtccctttg |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17945991 |
cttttttgacctgtaaatgtccctttg |
17946017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University