View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15606_low_19 (Length: 264)

Name: NF15606_low_19
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15606_low_19
NF15606_low_19
[»] chr8 (1 HSPs)
chr8 (24-250)||(17945791-17946017)


Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 24 - 250
Target Start/End: Original strand, 17945791 - 17946017
Alignment:
24 agtccatacaagaatcccaaaatgatcgtttggtttcgccatttcttcttcagttggtttgtcagttaatatgtgagttccaaaaggttgttttggtttt 123  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
17945791 agtccatacaagaatcccaaaatgatcgtttggttttgccatttcttcttcagttggtttgtcaattaatatgtgagttccaaaaggttgttttggtttt 17945890  T
124 gcactttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcacttgttttctcgagccatttgcgagttccaaaaaattgatttg 223  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17945891 acactttctttttgttcccaccatatgttaattccaaaaggttgtcttgcttttgcacttgttttctcgagccatttgcgagttccaaaaaattgatttg 17945990  T
224 cttttttgacctgtaaatgtccctttg 250  Q
    |||||||||||||||||||||||||||    
17945991 cttttttgacctgtaaatgtccctttg 17946017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University