View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15606_low_24 (Length: 213)

Name: NF15606_low_24
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15606_low_24
NF15606_low_24
[»] chr4 (1 HSPs)
chr4 (1-141)||(8879673-8879813)
[»] chr3 (1 HSPs)
chr3 (160-206)||(24720728-24720774)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 8879673 - 8879813
Alignment:
1 taatatcattaagttaaattcttgaggctaataaattttactaaagcatctacgtacatgctaaactcaatgctacattttatttttaaaggatcaatgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8879673 taatatcattaagttaaattcttgaggctaataaattttactaaagtatctacgtacatgctaaactcaatgctacattttatttttaaaggatcaatgc 8879772  T
101 tacatttttagaatttaacttaatagaaataagaaatgaaa 141  Q
    |||||||||||||||||||||||||||||||||||||||||    
8879773 tacatttttagaatttaacttaatagaaataagaaatgaaa 8879813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 24720774 - 24720728
Alignment:
160 tttctcacatcttgaggaattggtttatccttaacttattcatttca 206  Q
    ||||||| |||| |||||||||||||||| ||||||||||| |||||    
24720774 tttctcagatctggaggaattggtttatcattaacttattcgtttca 24720728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University