View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15606_low_24 (Length: 213)
Name: NF15606_low_24
Description: NF15606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15606_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 8879673 - 8879813
Alignment:
| Q |
1 |
taatatcattaagttaaattcttgaggctaataaattttactaaagcatctacgtacatgctaaactcaatgctacattttatttttaaaggatcaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8879673 |
taatatcattaagttaaattcttgaggctaataaattttactaaagtatctacgtacatgctaaactcaatgctacattttatttttaaaggatcaatgc |
8879772 |
T |
 |
| Q |
101 |
tacatttttagaatttaacttaatagaaataagaaatgaaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8879773 |
tacatttttagaatttaacttaatagaaataagaaatgaaa |
8879813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 24720774 - 24720728
Alignment:
| Q |
160 |
tttctcacatcttgaggaattggtttatccttaacttattcatttca |
206 |
Q |
| |
|
||||||| |||| |||||||||||||||| ||||||||||| ||||| |
|
|
| T |
24720774 |
tttctcagatctggaggaattggtttatcattaacttattcgtttca |
24720728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University