View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15610_high_5 (Length: 332)
Name: NF15610_high_5
Description: NF15610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15610_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 324
Target Start/End: Original strand, 33318450 - 33318757
Alignment:
| Q |
17 |
gtggagaccatcccacacctcnnnnnnnnattgtcactttgccattcatctttgaaattggctctttatcctcaaagtctctattgatctttcatatatc |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33318450 |
gtggagaccatcccacacctcttttttttattgtcactttgccattcatctttgaaattggctctttatcctcaaagtatctattgatctttcatatatc |
33318549 |
T |
 |
| Q |
117 |
aatttgcatggtttactaagaagttggtcccctcaatgccaaattgtgatgttagctgttattgtggatttggtgattataatttgatattgttgtaaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33318550 |
aatttgcatggtttactaagaagttggtcacctcaatgccaaattgtgatgttagctgttattgtggatttggtgattataatttgatattgttgtaaca |
33318649 |
T |
 |
| Q |
217 |
aaaacacgtttggcaacaaatatgttaattgcaactttgctaataatattgctgaatttgtcattttgaaatatttttcagttaatattaatgttgttta |
316 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
33318650 |
aaaacacgtttggcaacagatatgttaattgcaactttgctaataatgttgctgaatttgtcattttgaaatccttttcagttaatattcatgttgttta |
33318749 |
T |
 |
| Q |
317 |
ttcttctc |
324 |
Q |
| |
|
|||||||| |
|
|
| T |
33318750 |
ttcttctc |
33318757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University