View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15610_low_8 (Length: 251)
Name: NF15610_low_8
Description: NF15610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15610_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 156 - 232
Target Start/End: Original strand, 30744309 - 30744385
Alignment:
| Q |
156 |
taggacatggtttgaatgattggcgaaggtttacctgacttccaagtcgtgtcgtgcgttgtggtcttactggactg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
30744309 |
taggacatggtttgaatgattggcgaaggtttacctgacttccaagtcgtgtcatgcgtggtggtctcactggactg |
30744385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 30744238 - 30744297
Alignment:
| Q |
1 |
aataattaaggagattaaccaaatgacaaattgatgataatagtttaaatttgattcttg |
60 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30744238 |
aatagttaacgagattaaccaaatgacaaattgatgataataatttaaatttgattcttg |
30744297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University