View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15610_low_8 (Length: 251)

Name: NF15610_low_8
Description: NF15610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15610_low_8
NF15610_low_8
[»] chr3 (2 HSPs)
chr3 (156-232)||(30744309-30744385)
chr3 (1-60)||(30744238-30744297)


Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 156 - 232
Target Start/End: Original strand, 30744309 - 30744385
Alignment:
156 taggacatggtttgaatgattggcgaaggtttacctgacttccaagtcgtgtcgtgcgttgtggtcttactggactg 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||    
30744309 taggacatggtttgaatgattggcgaaggtttacctgacttccaagtcgtgtcatgcgtggtggtctcactggactg 30744385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 30744238 - 30744297
Alignment:
1 aataattaaggagattaaccaaatgacaaattgatgataatagtttaaatttgattcttg 60  Q
    |||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||    
30744238 aatagttaacgagattaaccaaatgacaaattgatgataataatttaaatttgattcttg 30744297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University