View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15611_high_37 (Length: 307)
Name: NF15611_high_37
Description: NF15611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15611_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 21 - 277
Target Start/End: Complemental strand, 41653598 - 41653342
Alignment:
| Q |
21 |
acatcatcaattgtaggcacaccagcatggggtaaccgaaccatattggcaaaccaaaaccattttggtgatttggttgtttttgatgatccaatcactt |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653598 |
acatcagcaattgtaggcacaccagcatggggtaaccgaaccatattggcaaaccaaaaccattttggtgatttggttgtttttgatgatccaatcactt |
41653499 |
T |
|
| Q |
121 |
tggacaataacttacactcacgcccaattggtcgtgctcaaggattttacatttatgataagaaagaaattttcactgcttggcttggtttctcatttgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653498 |
tggacaataacttacactcacgcccaattggtcgtgctcaaggattttacatttatgataagaaagaaattttcactgcttggcttggtttctcatttgt |
41653399 |
T |
|
| Q |
221 |
gtttaactctactcaacataagggtagcataaattttgttggtgctgaccctttgat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41653398 |
gtttaactctactcaacataagggtagcataaattttgctggtgctgaccctttgat |
41653342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University