View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15613_high_1 (Length: 548)
Name: NF15613_high_1
Description: NF15613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15613_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 798644 - 798356
Alignment:
| Q |
1 |
cgagtttgtttatagatttatgactggatctagatttatggctgaattagagagaacctgtacgaggaaagtcataaattattttttatcaaaatgatgg |
100 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
798644 |
cgagtctgtttatagatttatgattggatctggatttatggctgaattagagagaacctgtacgaggaaaatcataaatcattttttatcaaaatgatgg |
798545 |
T |
|
| Q |
101 |
cgttgatggggaatgcgccaaattagattgattttcgcttgttaaacaaagtttatgttctgttatgtaaaattttctaagcaagccttcttttcccaac |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
798544 |
cgttgatggggaatgcgtcaaattagattgattttcgcttgttaaacaaagcttatgttctgttctgtaaaattttctaagcaagccttcttttcccaag |
798445 |
T |
|
| Q |
201 |
gaaccagagagaacatgtatatatttgtctctattttgtatattttgctaggcaagcctaagtc----atctagcgagccaaacttaac |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
798444 |
gaaccagagagaacatgtatatatttgtctctattttgtaaattttgctaggcaagcctaagtcatcgatctagcgagccaaacttaac |
798356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 343 - 520
Target Start/End: Complemental strand, 798298 - 798121
Alignment:
| Q |
343 |
ataacacaattggacacttattgttggtatagttgtttgactactgtttacacgaggcaaaacactagaaagtcagatgctttaattgtgttcaattagt |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
798298 |
ataacacaattggacacttattgttggtatagttgtttgactactgtttacacgtggcaaaacaccagaaagtcagatgctttaattgtgttcaattagt |
798199 |
T |
|
| Q |
443 |
cgatagtcagatgcttggcaagaaattaactaaatggcaactcatggtatattgtagcagagtatttatgtactctct |
520 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
798198 |
cgatagtcagatgcttggcaagaaattaactaaatggcaactcgtggtatattgtagcagagtatttatgtactctct |
798121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 362 - 408
Target Start/End: Original strand, 14527408 - 14527454
Alignment:
| Q |
362 |
attgttggtatagttgtttgactactgtttacacgaggcaaaacact |
408 |
Q |
| |
|
||||||||||||||||||||| |||||| || |||| |||||||||| |
|
|
| T |
14527408 |
attgttggtatagttgtttgattactgtgtatacgatgcaaaacact |
14527454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University