View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15613_high_6 (Length: 348)
Name: NF15613_high_6
Description: NF15613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15613_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 13 - 348
Target Start/End: Original strand, 40885530 - 40885864
Alignment:
| Q |
13 |
aatattgaagaggattgcaaaacatcaaaagaaagtagaactttgttgggttcggactggagaacaatattcctatgggaacaatatgtctgcttaccct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885530 |
aatattgaagaggattgcaaaacatcaaaagaaagtagaactttgttgggttcggactggagaacaatattcctatgggaacaatatgtctgcttaccct |
40885629 |
T |
 |
| Q |
113 |
acaacatatcccagtggatactatccccctccatcagggtcctactatcggaattttgatccctatcaaaattatgatccttattttggtcctcagactc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885630 |
acaacatatcccagtggatactatccccctccatcagggtcctactatcagaattttgatccctatcaaaattatgatccttattttggtcctcagactc |
40885729 |
T |
 |
| Q |
213 |
atggttatcctccatataacaattattatatgtaaaacagatggatctatcaccactccaacagtatagtattagtatcactgttggtgtttttgtgnnn |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40885730 |
atggttatcctccatataacaattattatatgtaaaacagatggatgttgcaccactccaacagtatagtattagtatcactgttggtgtttttgtg-tt |
40885828 |
T |
 |
| Q |
313 |
nnnnattaagtcctttgtattggtattaggtcatat |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40885829 |
ttttattaagtcctttgtattggtattaggtcatat |
40885864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University