View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15615_high_1_N (Length: 465)
Name: NF15615_high_1_N
Description: NF15615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15615_high_1_N |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 6 - 295
Target Start/End: Original strand, 37375711 - 37375992
Alignment:
| Q |
6 |
gtagattatactatgattattccaaatatccgatgcacactttcacgtgttaacatgaatgggacaatatatcttgaagtgtttgcccaagaatatatgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37375711 |
gtagattatactatgattattccaaatatccgatgcacactttcacgtgttaacatgaatgggacaatatctcttgaagtgtttgcccaagaatatatgt |
37375810 |
T |
 |
| Q |
106 |
gtcccattggttttatggcaacgtgaaatcgtgaagtgttgctgctaacaaaaacttcagcatggaattcaagcacgtgtcagatcagatctgtacatta |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37375811 |
gtcccattggttttaaggcaacgtgaaatcgtgaagtgttgctgcta--------ttcagcatggaattcaagcacgtgttagatcagatctgtacatta |
37375902 |
T |
 |
| Q |
206 |
caattacaaagaatggataagaagtataattaacttatttgtttatttatttaccaaactgcaattcaatatttttgtatacccttagga |
295 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37375903 |
caattacaaacaatggataagaagtataattaacttatttgtttatttatttaccaaactgcaattcaatatttttgtatacccttagga |
37375992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University