View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15615_low_2 (Length: 239)
Name: NF15615_low_2
Description: NF15615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15615_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 92 - 225
Target Start/End: Original strand, 48482619 - 48482752
Alignment:
| Q |
92 |
ttcactgtagaacgcaactgtacatttaaacaatatcaacatattttcccagcagcggaagtaatagccatgtaactaaatgcttacttccataaaaatc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482619 |
ttcactgtagaacgcaactgtacatttaaacaatatcaacatattttcccagcagcggaagtaatagccatgtaactaaatgcttacttccataaaaatc |
48482718 |
T |
|
| Q |
192 |
tatatattgattatggacataaatgactttgctg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48482719 |
tatatattgattatggacataaatgactttgctg |
48482752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 7691630 - 7691565
Alignment:
| Q |
19 |
agatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggtt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691630 |
agatactactcattctcatttcactttatgttctctctttcttcccaatatcatactccacaggtt |
7691565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 13890357 - 13890292
Alignment:
| Q |
19 |
agatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggtt |
84 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
13890357 |
agatactagtcattctcatttcactctatactctctctttcttcccattatcatatcccacaggtt |
13890292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 14030482 - 14030417
Alignment:
| Q |
19 |
agatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggtt |
84 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
14030482 |
agatactagtcattctcatttcactctatactctctctttcttcccattatcatatcccacaggtt |
14030417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University