View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15616_high_2 (Length: 277)
Name: NF15616_high_2
Description: NF15616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15616_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 22016548 - 22016815
Alignment:
| Q |
1 |
ttgctactcttctatctttggatttgctataaggttacttttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgc |
100 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016548 |
ttgctacacttctaactttggatttgctataaggttacttttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgc |
22016647 |
T |
 |
| Q |
101 |
aattcctgatcgatttttgtgttctacgctatttaccgaagcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016648 |
aattcctgatcgatttttgtgttctacgctatttaccgaagcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaaga |
22016747 |
T |
 |
| Q |
201 |
tgatctatccatggtagaaactgaacgtaatgaagggacagataataatgaaaataatgctgatgatg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22016748 |
tgatctatccatggtagaaactgaacgtaatgaagggaaagataataatgaaaataatgctgatgatg |
22016815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 232 - 266
Target Start/End: Original strand, 22016830 - 22016864
Alignment:
| Q |
232 |
gaagggacagataataatgaaaataatgctgatga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016830 |
gaagggacagataataatgaaaataatgctgatga |
22016864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University