View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15618_high_5 (Length: 289)
Name: NF15618_high_5
Description: NF15618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15618_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 99 - 280
Target Start/End: Original strand, 39700660 - 39700841
Alignment:
| Q |
99 |
attgtatatataagacttcaaaaatactcacgatcacaacgtaaatctttctcaaagtgtttattctctctctaatacaaatcaaattgaatacaaaacc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39700660 |
attgtatatataagacttcaaaaatactcacgatcacaacgtaaatctttctcaaagtgtttattctctctctaatacaaatcaaattgaatacaaaacc |
39700759 |
T |
 |
| Q |
199 |
ttcccacagatgggattccatttcaaacaatataattgtcatgaaacataggaagtaatctaagttctctttccatgatgat |
280 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39700760 |
ttcctacaaatgggattccatttcaaacagtataattgtcatgaaacataggaagtaatctaagttctctttccatgatgat |
39700841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 76
Target Start/End: Original strand, 39700604 - 39700640
Alignment:
| Q |
40 |
gataattaatatacaattgtatatgatttggcttgtc |
76 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39700604 |
gataattaatatacaattgtatatgattaggcttgtc |
39700640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University