View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15618_low_3 (Length: 335)
Name: NF15618_low_3
Description: NF15618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15618_low_3 |
 | |
|
| [»] scaffold0140 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 317
Target Start/End: Complemental strand, 37239 - 36939
Alignment:
| Q |
19 |
cagaacataagtggtccaaaggaagcaactcagaaccagccattgccac-atgactttattgatgacacaactcatgttattactggtttgttgaaatgt |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| || | || |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37239 |
cagaacataagtggtctaaaggaagcaactcagaaccagccattgccaccatcaaatt-ttgatgacacaactgatgttattactggtttgttgaaatgt |
37141 |
T |
|
| Q |
118 |
caaaagaa-tattgcaaaagtt-caaggcaagaaggtcatgactgttgggggtccatcagagactcaagctgaagcaatgttgagagacctgaagatgct |
215 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37140 |
caaaagaaatattgcaaaagttacaaggcaagaaggtcatgactgttgggggtccatcagagagtcaagctgaagcaatgttgagagacctgaagatgct |
37041 |
T |
|
| Q |
216 |
tccaccagaggaactagagaaggttacaagggagttggtgacaggcctagtgaattggaatgagaatattcacaagaacaaccaagcaaaaggaactgat |
315 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37040 |
tccaccagaggaactagaaaaggttacaagggagttggtcacaggtctagtgaattggaatgagaatattcagaagaacaaccaagcaaaaggaactgat |
36941 |
T |
|
| Q |
316 |
gg |
317 |
Q |
| |
|
|| |
|
|
| T |
36940 |
gg |
36939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 24 - 54
Target Start/End: Complemental strand, 37264 - 37234
Alignment:
| Q |
24 |
cataagtggtccaaaggaagcaactcagaac |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37264 |
cataagtggtccaaaggaagcaactcagaac |
37234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University