View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15618_low_6 (Length: 312)
Name: NF15618_low_6
Description: NF15618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15618_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 103 - 298
Target Start/End: Original strand, 3046139 - 3046330
Alignment:
| Q |
103 |
ttccgccagttattattatgattattgtacttcacgtatgttgatgctccatccaaccccattacatagaagacattacatcaatcatacctagtggaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| |||| ||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3046139 |
ttccgccagttattattatgattattgtacttgacatatgctgatactcca----accccattacatagaagacattacatcaatcataactagtggaaa |
3046234 |
T |
|
| Q |
203 |
gacacacgtctttctccgcttccataaattaactacaatcattgagcttccaaatatggaagacttccttcatccaaccaaatcgagattcattct |
298 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3046235 |
gacgcacgtctttcttcgcttccataaattaactacaatcattgagcttccaaatatggaagtcttccttcatccaaccaaatcgagattcattct |
3046330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 12 - 91
Target Start/End: Original strand, 3045769 - 3045854
Alignment:
| Q |
12 |
atcatcaatgaggccacgagactggttagttgttgttgctgttattattat------tactatgcaacaagagattttatcaacac |
91 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
3045769 |
atcaacaacgaggccacgagactggttagttgttgttattattattattattattactactatgcaacaagagattttatgaacac |
3045854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University