View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15622_high_4 (Length: 229)
Name: NF15622_high_4
Description: NF15622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15622_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 218
Target Start/End: Complemental strand, 33933550 - 33933339
Alignment:
| Q |
7 |
tattagtcctccaaagaattttcaccaattagtctctcttaaattcatcatacgaatcactgtgctggtgacnnnnnnnnggctaatttggttacaattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33933550 |
tattagtcctccaaagaattttcaccaattagtctctcttaaattcatcatacgaatcactgtgctggtgacaaaaagaaggctaatttggttacaattt |
33933451 |
T |
 |
| Q |
107 |
tatatatcagtgactggtttgatgaagacttcttaaggaaaaattcagtaatagttcaattgtctgagagactaatttggtgataaaatctatagggggc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33933450 |
tatatatcagtgactggtttgatgaagacttcttgaggaaaaattcagtaatagttcaattgtctgagagactaatttggtgataaaatctatagggggc |
33933351 |
T |
 |
| Q |
207 |
taatgtgatgat |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33933350 |
taatgtgatgat |
33933339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University