View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15623_high_2 (Length: 285)
Name: NF15623_high_2
Description: NF15623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15623_high_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 9 - 285
Target Start/End: Original strand, 7155927 - 7156203
Alignment:
| Q |
9 |
ggaagggttcttgataaacctcaggaagtggcataatattaagaacaaggcgatatcaaactatcatgatagacttctggacacaaccggccgttgatcg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7155927 |
ggaagggttcttgataaacctcaggaagtggcataatattaagaacaaggcgatatcaaactatcatgatagacttctggacaccaccggccgttgatcg |
7156026 |
T |
 |
| Q |
109 |
tttgaattcccaaagccttaaaagtaccatctgtcgaattgtaaacaaccaattcgtgcacgttccccagcaacagttggtcatcgttggaaacataaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156027 |
tttgaattcccaaagccttaaaagtaccatctgttgaattgtaaacaaccaactcgtgcacgttccccagcaacagttggtcatcgttggaaacataaag |
7156126 |
T |
 |
| Q |
209 |
ggctttgtaatatggacaaaaattacgagcttgtatgtcagcatctcccatgtaaggaacagagaacaatttagccc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7156127 |
ggctttgtaatatggacaaaaattacgagctggtatgtcagcatctcccatgtaaggaacacggaacaatttagccc |
7156203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University