View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15624_high_19 (Length: 324)
Name: NF15624_high_19
Description: NF15624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15624_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 73 - 302
Target Start/End: Original strand, 39782889 - 39783118
Alignment:
| Q |
73 |
atcacttgatccagttgaagatgaagacaaactatgtcctgattctgaagttagtggtgtttcaattttcttgctacggttataactcgacgggcctaat |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39782889 |
atcacttgatccagttgaagatgaagacaaactatgtcctgattctgaagttagtggtgtttcaattttcttgctacggttataactcgacgggcctaat |
39782988 |
T |
 |
| Q |
173 |
gtcagctcaatttcagtctcgtcgatgatctctagctcctcgtcatctgattctgcagtgtgctcctctgcaggcctttcaagatcaaatttgatttgag |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39782989 |
gtcagctcaatttcagtctcgtcgatgatctctagcccctcgtcatctgattctgcagtgtgctcctctgcaggcctttcaagatcaaatttgatttgag |
39783088 |
T |
 |
| Q |
273 |
ccttttcttgtccacctttataatgatgat |
302 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
39783089 |
tcttttcttgtccacctttatgatgatgat |
39783118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University