View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15627_high_18 (Length: 326)
Name: NF15627_high_18
Description: NF15627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15627_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 39 - 144
Target Start/End: Original strand, 42309447 - 42309552
Alignment:
| Q |
39 |
tcatgacccaactaggagactttttattttgtgaaaaagccaaagttttcaatgtagtggtttcagggtactaatatttccatttaccctcttttatcta |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42309447 |
tcatgacccaactaggagactttttattttgtgaaaaaaccaaagtgttcaatgtagtggtttcagggtactaatatttccatttaccttcttttatcta |
42309546 |
T |
|
| Q |
139 |
ttttag |
144 |
Q |
| |
|
|||||| |
|
|
| T |
42309547 |
ttttag |
42309552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 207 - 293
Target Start/End: Original strand, 42309603 - 42309689
Alignment:
| Q |
207 |
ctatcttttagaaaggaatataattttatatgttcatcttgcattgcctctgtttctttgtgcagtttatgatttgcttggactgtt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42309603 |
ctatcttttagaaaggaatataattttatatgttcatcttgcattgcctctgtttctttgtgcagtttatgatttgcttggactgtt |
42309689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University