View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15627_high_22 (Length: 321)
Name: NF15627_high_22
Description: NF15627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15627_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 20 - 292
Target Start/End: Complemental strand, 5690918 - 5690646
Alignment:
| Q |
20 |
gacatcatcacattgttgaagaatgaggggttacatgtggattatagtttgaggtatgttaaataaagatggcaatcttgtgggtgggtggttgtgttgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5690918 |
gacatcatcacattgttgaagaatgagaggttacatgtggattatagtttgaggtatgttaaataaagtgggcaatcttgtgggtgggtggttgtgttgt |
5690819 |
T |
|
| Q |
120 |
tgagattgaaagaaactcctggtaaatgaggtgattgtgttggtgttatttttggcgaattgagtggtggcttgggtgtgtatgagaatgagaacaaagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5690818 |
tgagattgaaagaaactcctggtaaatgaggtgattgtgttggtgttatttttggcgaattgagtggtggcttgggtgtgtatgagaatgagaacaaagg |
5690719 |
T |
|
| Q |
220 |
ggtgaagtgatggtggttctaggcctagcaagaaagttcacagacagctacagagattataggcttcaaatat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5690718 |
ggtgaagtgatggtggttctaggcctagcaagaaagttcacagacaggtacagagattataggcttcaaatat |
5690646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University