View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15627_high_23 (Length: 320)
Name: NF15627_high_23
Description: NF15627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15627_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 22 - 291
Target Start/End: Original strand, 44112594 - 44112864
Alignment:
| Q |
22 |
atcatcatatcatacgactaat-ataagttgcaagaggaatgccactgaaagaagctttggagcgtagcaacatcagctctgtggtgtttttgtgtaaat |
120 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44112594 |
atcatcatatcatatgattaattataagttgcaagaggaatgccactgaaagaagctttggagcgtagcaacatcagctctgtagtgtttttgtgtaaat |
44112693 |
T |
|
| Q |
121 |
tcaaacaaacttgaccatgtaaaatcagggtactttcttgcctcatttttgcttaacaaattttctgggggtctcaccgctttgtcttctcttggacaca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44112694 |
tcaaacaaacttgaccatgtaaaatcagggtactttcttgcctcatttttgcttaacaaattttctgggggtctcaccactttgtcttctcttggacaca |
44112793 |
T |
|
| Q |
221 |
caaagaaaaccagtgaccttctttcactgtatctgttcactaatgccctgtggaggcaactcttgtatctt |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44112794 |
caaagaaaaccagtgaccttctttctctgtatctgttcactaatgccctgtggaggcaactcttgtatctt |
44112864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University