View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15629_high_1 (Length: 211)
Name: NF15629_high_1
Description: NF15629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15629_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 46907758 - 46907958
Alignment:
| Q |
1 |
tacgtttgcagtcctcactattttgttggcatatttttataataaaaaatagtatgtagtgagttaacatctcagagctttgcttcctccacacactgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46907758 |
tacgtttgcagtcctcactattttgttggcatatttttataataaaaaatagtatgtagtgagttaacatctcagagctttgcttcctccacacactgca |
46907857 |
T |
 |
| Q |
101 |
tttcccatttcctttgccttttttataagctgattgtacaactttcttatctagatgctcagtggttcagtagagaagatataagaaaagcattgatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46907858 |
tttcccatttcctttgccttttttataagctgattgtacaactttcttatctagatgctcagtggttcagtagagaagatataagaaaagcattgatgat |
46907957 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
46907958 |
g |
46907958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 139 - 191
Target Start/End: Complemental strand, 23349770 - 23349718
Alignment:
| Q |
139 |
caactttcttatctagatgctcagtggttcagtagagaagatataagaaaagc |
191 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
23349770 |
caactttcttatgtagatgctcagtggcacagtagagaagatgtaagaaaagc |
23349718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University