View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15629_high_33 (Length: 311)
Name: NF15629_high_33
Description: NF15629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15629_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 179 - 272
Target Start/End: Complemental strand, 44104655 - 44104558
Alignment:
| Q |
179 |
attcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaa----atatgatggaatggagtggtatggaatgtggt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44104655 |
attcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaaatatatatgatggaatggagtggtatggaatgtggt |
44104558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 44104791 - 44104738
Alignment:
| Q |
43 |
ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttgg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44104791 |
ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttgg |
44104738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 305
Target Start/End: Complemental strand, 44104540 - 44104507
Alignment:
| Q |
272 |
tgaaaaattagtggaatagagtgatgtatgatga |
305 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
44104540 |
tgaaaaattagtggaatagagtgatatatgatga |
44104507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University