View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1562_high_3 (Length: 276)
Name: NF1562_high_3
Description: NF1562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1562_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 45 - 248
Target Start/End: Original strand, 25509967 - 25510175
Alignment:
| Q |
45 |
tataactttggttttaagtgacaactgcaagttcattgctttattgcatagcaaagttcagaa-tgataaaacttaagcttttgaaaagtatctgtattt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25509967 |
tataactttggttttaagtgacaactgcaagttcattgctttattgcatagtaaagttattaaatgataaaatttaagcttttgaaaagtatctgtattt |
25510066 |
T |
|
| Q |
144 |
gacacttg----tgtaatgtattgtgcagaatatatggaagattcgtcttcaacttacaaagcctgtaacttggcctcctttagtttggggtgtagtctg |
239 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| ||||| || |
|
|
| T |
25510067 |
gatacttcattttgtaatgtattgtgcagaatatatggaagattcgtctgcaacttacaaagcctgtaacttggcctccattagtgtggggggtagtttg |
25510166 |
T |
|
| Q |
240 |
tggtgctgc |
248 |
Q |
| |
|
||||||||| |
|
|
| T |
25510167 |
tggtgctgc |
25510175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University