View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1562_high_7 (Length: 250)
Name: NF1562_high_7
Description: NF1562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1562_high_7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 6035617 - 6035383
Alignment:
| Q |
17 |
gtacccaaaacctaactaatatttctgttttgttttaagggatcatcacatgcccaacttaattgttttgcatgaaaatggaaaacatagaattcatggg |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6035617 |
gtacccaaaacctaactactatttctgttttgttttaagggatcatcacatgcccaacttaattgttttgcatgaaaatggaaaacatagaattcatggg |
6035518 |
T |
 |
| Q |
117 |
agaaagatgtttggttgcatgctccacaagaaaatgcacttcctgtaaaattannnnnnnnccctattttatttgttcgtcgtttgattattttgtaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6035517 |
agaaagatgtttggttgcatgctccacaagaaaatgtacttcctgtcaaattattttttttccctattttatttgttcgtcgtttgattattttgtaatt |
6035418 |
T |
 |
| Q |
217 |
atg-atataatggaaatatattagtgatgatggac |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6035417 |
atgaatataatggaaatatattagtgatgatggac |
6035383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University