View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1562_low_3 (Length: 323)
Name: NF1562_low_3
Description: NF1562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1562_low_3 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 97 - 232
Target Start/End: Original strand, 46209 - 46344
Alignment:
| Q |
97 |
aatacattagaaatgtaagtgacctccgattataaataacgaggttactccctctgcttaacatagtatttgataaagcagttcagttttctctttgcta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46209 |
aatacattagaaatgtaagtgacctccgattataaataacgaggttactacctctgcttaacatagtatttcataaagcagttcagttttctctttgcta |
46308 |
T |
 |
| Q |
197 |
catacgaggagagtagataattggtgtgtagtaagt |
232 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46309 |
catacgaggagagcagataattggtgtgtagtaagt |
46344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University