View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15630_high_4 (Length: 344)
Name: NF15630_high_4
Description: NF15630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15630_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 72 - 332
Target Start/End: Original strand, 7899156 - 7899403
Alignment:
| Q |
72 |
cttttggttagcacaagaaacacgtttgcctattctattctcatgtctctctcacccttcattatatttatcagtattcgcaatacatatcataacataa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
7899156 |
cttttggttagcacaagaaacacgtttgcctattctattcttctgtctctctcacccttcattatatttat----attc-----acatatcataacataa |
7899246 |
T |
 |
| Q |
172 |
ccaattcaagcaacaaaatcataaaaatacttttcccaatgatggaaattcgtaagcaacaaaaacccatcaaatttagtagtaggttcaaacgtatttg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899247 |
ccaattcaagcaacaaaatcataaaaatacttttccctattatggaaattcataagcaacaacaacccatcaaatttagtagtaggttcaaacgtatttg |
7899346 |
T |
 |
| Q |
272 |
tgtcttctgtggaaccagctagccctggcaaaaatcccatctatcaacatgctgctattca |
332 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7899347 |
tgtcttctgtggcacc----agccctggcaaaaatcccatctaccaacatgctgctattca |
7899403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 3 - 55
Target Start/End: Original strand, 7898720 - 7898772
Alignment:
| Q |
3 |
aattctcatagattcccttcactcacttttggccatttgttttccaacaaaca |
55 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898720 |
aattcttatagattcccttcactcacttttggccatttgttttccaacaaaca |
7898772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 207 - 255
Target Start/End: Original strand, 7883740 - 7883787
Alignment:
| Q |
207 |
ccaatgatggaaattcgtaagcaacaaaaacccatcaaatttagtagta |
255 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7883740 |
ccaatgatggaaattcataagcaac-aaaacccatcaaatttagtagta |
7883787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University