View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15630_high_6 (Length: 326)
Name: NF15630_high_6
Description: NF15630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15630_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 52087515 - 52087204
Alignment:
| Q |
1 |
acaacacctgtgtatgactgttcttcattgaagcatgatggtgtacctgcaaagacattctaatactcaagttatg-gggnnnnnnnaaagagcttttag |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
52087515 |
acaacacctgtgtacgactgttcttcattgaagcacgatggtgtacctgcaaagacattctaatactcaagttatatgggggtttttaaagagcttttag |
52087416 |
T |
|
| Q |
100 |
gtattttctaagtatatgannnnnnnnnnnnncatgnnnnnnnnagcgagttgagttgctctattttatagattgtttattgtgccatgtaggcttgatc |
199 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52087415 |
gtattttctaagtatatgagtgtgtgtg----catgttttttttagcgagttgagttgctgtattttatagattgtttattgtgccatgtaggcttgatc |
52087320 |
T |
|
| Q |
200 |
agtttgacggttgcacattttgtgatgtgagggctgagcgaatatttgatctttttagtcacaataccaacccctttcttaacagccatcaagcttctca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52087319 |
agtttgacggttgcacattttgtgatgtgagggctgagcgaatatttgatctttttagtcacaataccaatccctttcttaacagccatcaagcttctca |
52087220 |
T |
|
| Q |
300 |
gattcaatcatctgtg |
315 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
52087219 |
gattcaatcatttgtg |
52087204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University