View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15631_low_1 (Length: 272)
Name: NF15631_low_1
Description: NF15631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15631_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 269
Target Start/End: Complemental strand, 36253714 - 36253465
Alignment:
| Q |
20 |
ttgacattaacaatgacgattcagacaatgaaaagtttgacaatgacaatgttgaagaccaaatggacaatgtggatgatgatgaaaaggaccattttct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36253714 |
ttgacattaacaatgacgattcagacaatgaaaagtttgacaatgacaatgttgaagaccaaatggacaatgtggatgatgacgaaaaggaccattttct |
36253615 |
T |
 |
| Q |
120 |
aggtccttacaatgtggatgaagaccaaatggacaacattcccattgcacttgccgtttctgatgcatcccccgttgtgacggtggccatggctgccccc |
219 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36253614 |
atgtccatacaatgtggatgaagaccaaatggacaatattcccattgcacttgccgtttctgatgcatcccccgttgtgacggtggccatggctgccccc |
36253515 |
T |
 |
| Q |
220 |
gcagatgacacaaacgcggcaacaaacacagccaccacctatgctactac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36253514 |
gcagatgacacaaacgcggcaacaaacacagccaccacctcggctactac |
36253465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University